Journal of Phytopathology and Pest Management 5(2): 108-128, 2018

pISSN:2356-8577 eISSN: 2356-6507

Journal homepage: http://ppmj.net/

∗

Corresponding author:

Rabie A.S. Elshafey,

E-mail: relshafey13@yahoo.com

108

Biology of rice kernel smut disease causal

organism

Tilletia barclayana

and its

molecular identification

Rabie A.S. Elshafey

*

Rice Research and Training Center, Rice Research Department, Field Crops Research Institute,

Agricultural Research Center, 33717 Sakha, Kafr El-Sheikh, Egypt

Abstract

Keywords: rice, kernel smut disease, Tilletia barclayana, teliospore, resistance, varieties.

In Egypt, Rice kernel smut disease is a new production biotic constrains, the kernel

smut of rice is caused by Tilletia barclayana, which started in appearance in different

rice growing governorates, especially in Belkas, Dakahlia governorate whereas the

cultivation of cultivar Giza 178 was concentrated in this area. The study aimed to

investigate the life cycle of the causal organism of rice kernel smut disease "Tilletia

barclayana" and determine all growth stages of this fungus and its relationship with

the host '' Oryzae sativa, L'', in addition, molecular identification of this fungus. The

life cycle of this disease was investigated; teliospore was germinated as emerging

germ-tube and bear a promycelium. This promycelium bear from 20-100 filliform

basidiospores at the tip of the promycelium. The non-conjugated basidiospores were

germinated and produced mycelium. Both filliform and allantoid sporidia (Crescent-

shaped conidia) generally develop from that mycelium on short sterigmata. The

allantoid sporidia discharged from strigmata, then was germinated and produced

binucleate mycelium which able to infect the different floral tissues, ovary and

produced smut balls of teliospores. Concerning the proper time for artificial

inoculation, Inoculation at flowering stage induced the highest infection with all

cultivars. Inoculation at milking stage recorded the second rank of infection with the

cultivar Giza 171. The lowest infection was recorded from inoculation at seedling and

maximum tillering. In addition, both the highest infection at flowering stage proofed

that the infection was local not systemic. For the proper spore type to artificial

inoculation, Allantoid spores induced the highest infection % because it germinate

and directly gave the binucleate mycelium which able to invasive the ovary and all

tissues of opening spikelets, followed by the filliform sporidia which recorded the

second rank of infection %, while teliospores induced the lowest infection %. For the

survival of teliospores, the teliospores can survive for more than 2 years and provided

the initial inoculum source from season to season. For host resistance, there are a

significant source of resistance in the breeding program such as Sakha 101, Giza 179,

Sakha 105, Sakha 106, some GZ lines; GZ 10101, GZ10144, GZ 10154 and GZ10305.

So, detection of new resistance resources allow to further progress in establishing a

successful breeding program of kernel smut For molecular identification based on

ITS region, the Egyptian isolates reflected high level of identity with kernel smut from

USA, China and India ranged from 80-100%.

Elshafey, 2018

109

Introduction

Rice kernel smut disease is fungal disease

caused by

Neovossia horrida

(Takah.)

Padwick & A. Khan (syn.

Tilletia

barclayana

(Bref.) Sacc. & P. Syd.)

Tilletiales (Vánky, 2001; Castlebury et

al., 2005), which, like

T. indica

, causes a

partial bunt that affects both yield and

quality. Rice kernel smut disease is a new

production constrains specially in some

locations of Egypt such as Belkas,

Dakahlia governorate that had a wide

cultivated areas of Giza 178 rice cultivar

(Elshafey, 2013). Kernel smut that causes

a partial or complete replacement of rice

grains contents of panicle with teliospores

masses as a direct effect on grain yield

and quality (Webster & Gunnell, 1992).

Rice kernel smut, recognized as caryopsis

smut, black smut (Biswas, 2003), was

widespread and presents almost in all

rice-grown ecosystems worldwide. It has

found in upland or irrigated rice growing

countries (Elshafey, 2013; Farr et al.,

2005; Biswas, 2003; Chahal, 2001;

Webster & Gunnell, 1992; CMI. 1991;

Ou, 1985). It was considered as an

endemic disease, extended to epidemic

level, chronic problem, and persistent in

southern USA rice production areas

especially with parboiled rice. In

addition, It consider as minor disease but

can be changed to major in some rice

production areas such as India and

southern USA and recorded remarkable

yield losses (Brooks et al., 2009; Carris et

al., 2006; Chahal, 2001). Kernel smut

considered as minor with sporadic nature

but became important economical rice

fungal diseases with severe quality and

yield losses in Texas (Uppala et al.,

2017).

The direct grain yield losses can

be reached to 15% in addition to a

significant loss of rice grain quality

(Gravois & Bernhardt, 2000; Sharma et

al., 1999; Webster & Gunnell, 1992;

Whitney 1992). Kernel smut was an air-

borne whereas secondary sporidia,

forcibly discharged into the air and infect

floral tissues through open florets as a

local infection. While, a soil-borne

teliospores play an important role in

infection process as primary inoculum

(Whitney, 1992).

Tilletia barclayana

can

be able to infect many grasses in addition

to rice host, highly specific fungus on

their hosts and organs and localized in its

infection on florets and ovary (Singh &

Pavgi, 1972; Whitney, 1992). Survival of

pathogen play a crucial role in

epidemiology and disease development,

whereas, teliospores as a primary source

of infection with thick-wall it provided

the ability to survive at least wintering

from season to another. Therefore,

starting rice cultivation with healthy

seeds is main point in management

(Chahal, 2001). For resistance of kernel

smut, many cultivars are resistant under

natural field infection but few germplasm

resistant using boot inoculation technique

(Cartwright et al., 1996; Lee et al., 1991).

Therefore, screening under natural

infection with providing a source of

inoculum could improve discovery of

field resistant germplasm. Under the

threat of climate change could be kernel

smut shifted from minor to major disease

and causes severe problems. Therefore,

understanding biology of pathogen was

the critical point in host-pathogen

interaction and integration disease

management. The main objectives of

current study were: isolation, clarify the

growth nature of this fungus, life cycle

and host pathogen interaction

relationship throughout varietal

resistance. Molecular identification with

ITS region and compare sequence

analysis of some Egyptian isolates with

worldwide through NCBI website.

Elshafey, 2018

110

Materials and methods

Isolation of the causal pathogen:

Full

matured rice grains that showed

characteristic kernel smut symptoms

were collected. The mass of mature

teliospores of

T. barclayana

were

surface-sterilized 0.5% NaClO (5 %

vol/vol commercial bleach) for 2-3

minutes and rinsed with sterilized water

several times. Then, teliospores were

streaked on 2% water agar media to

germinate. Individual teliospores was

picked and transferred into an antibiotic-

containing potato dextrose agar media

and incubated in an incubator at 29° C.

Two weeks later, teliospores were

examined for full germination. Each of

germinated single colony was transferred

to Potato Sucrose Agar (PSA) medium

again to maintain pure isolates of causal

organism and cultured in incubator. For

long preservation, 1 ml of allantoid

sporidia suspension on potato sucrose

broth of 7-days old culture covered with

1 ml sterilized glycerol 35% in cryptovail

at -80˚c.

Tilletia barclayana

life cycle and long-

term storage:

The entire germination

process of teliospores was illustrated in

details. Teliospores were examined

microscopically at ×40 magnification to

determine time of germination.

Teliospores were considered germinated

once emerging of germ-tube and

basidiospores had formed on

promycelium. Each type of spores and all

life cycle was distinguished and each

stage illustrated. All special microscopic

features and measurements were

determined based on fifty randomly

samples of fully matured spores. For

impact of long-term storage, one hundred

mature teliospores were examined in

interval 6-month for each of three

replicates throughout two years and half

under room temperature during 2015-

2017 seasons. In addition, based on

samples of 100 teliospores, germination

% was calculated during different storage

periods to determine teliospores survival

and overwinter.

Detection of resistance resources:

During 2015 and 2016 seasons, field

experiments were carried out in Rice

Research and Training Center (RRTC)

experimental farm, Sakha, Kafr EL-

Sheikh to evaluate the varietal resistance

of kernel smut disease. Twenty rice

Egyptian varieties, with a wide variation

in their duration period and types, were

artificially inoculated under open field

conditions and allocated in a randomized

complete block design with four

replicates. Twenty-five days old

seedlings of each cultivars was

transplanted in plots measured 2×2 m

2

at

20 × 20 cm. Urea (46 % N) was added in

accordance to the recommendation

package of each cultivar. All cultural

practices were applied as recommended.

During flowering stage with opening

florets, all cultivars were inoculated at

(10-1 pm) with allantoid sporidia

suspension of 4 × 10

5

sporidia/ ml of the

most aggressive isolate Eg 01. Gelatin

2.5 g/L was used to induce smut

infection through increase adhesion of

spores on florets (Elshafey et al., 2015).

Samples were collected at the end of

season and infection scored based on

infected panicles and grains /m

2

.

Effect of inoculation date and type of

spores on disease infection:

For

preparation of spore suspension, five

Elshafey, 2018

111

colonies of 15-days growing culture of

Tilletia barclayana

fungus were

inoculated into 150 mL potato sucrose

broth medium in 250 ml Erlenmeyer

flasks, The inoculated flasks were

incubated at 28 c for 7 days in an orbital

shaker (120 rpm) under continuous

fluorescent light. Each type of spores was

separated based on the age of culture and

their pigment. The highly susceptible

cultivar Giza 171 was transplanted in

plots measured 2×2 m

2

at 20 × 20 cm in a

randomized complete block design with

four replicates. Rice plants were

inoculated at different growth stages;

seedling stage, maximum tillering, late

booting, flowering and complete heading

with allantoid spores at 4 × 10

5

sporidia/

ml from 14-days old culture of isolate

Eg 01 to investigate the impact of

inoculation date on severity of kernel

smut. In additional trail, Japonica rice

cultivar Giza 171 was inoculated with

different types of spores; teliospores,

filliform and allantoid sporidia after

complete flowering at 12 pm. Plants were

inoculated by spraying a suspension of

secondary sporidia (10

5

-10

6

/ ml) of the

smut fungus onto the opening florets

during flowering stage. All infected

panicles/m

2

were counted.

Disease parameters:

The response of

different rice varieties to kernel smut

disease was evaluated according to

disease parameters as follow with Slaton

et al. (2004) and Elshafey (2013):

Infection percentage as number of

infected panicles /m

2

. Infection severity

as number of infected spikelets /m

2

.

Differentiation among various isolates of

Tilletia barclayana

: All isolates were

grown on potato sucrose media (200g

potato, 40g sucrose, 20g agar/ 1 distilled

water) incubated in incubator at 29° C

for two weeks. Then, fully growth

cultures were categorized in different

categories based on compare

morphological traits specially secretion

of specific pigment and nature of growth

on the media.

Extraction of fungal DNA:

Two

isolates of Kernel smut fungus (Eg 01,

Eg 02,) were selected based on

morphological variation such as red and

violet pigments and virulence. Mycelium

of each isolate was scraping from the

surface of a 10-day old culture. The

mycelia (approx. 100 mg) were ground

in liquid nitrogen. DNA was extracted

from the powdered tissue using i-

genomic plant DNA extraction Mini Kit

(iNtRON Biotechnology, Inc, Cat.

No.17371) according to manufacturer’s

instructions. The eluted DNA was stored

at -20 ºC until use.

Amplification of ITS region:

Amplification of internal transcribed

spacer (ITS) region was conducted in an

automated thermal cycler (C1000 TM

Thermal Cycler, Bio-RAD) using the

primer pair: ITS4 (5´

TCCTCCGCTTATTGATATGC 3ˊ) and

ITS5 (5´

GGAAGTAAAAGTCGTAACAAGG

3ˊ) primers (White et al., 1990). The

following parameters were applied: 35

cycles of 94ºC for 30 s, 51ºC for 1 min,

72ºC for 1.5 min, and a final

extension at 72ºC for 3 min. Each PCR

mixture (25 µl) as follow, (1 µl) of 25

ng nucleic acid, 1 µl of each primer (10

pmol), (12.5 µl) of GoTag®Colorless

Master Mix (Promega Corporation,

USA) and 9.5 µl of Nuclease free water

(Promega). Negative control contained

Elshafey, 2018

112

the same PCR reagents, but no DNA. 15

µl of all PCR products were analyzed by

electrophoresis through a 1% agarose gel

(Sigma), stained with ethidium bromide,

and DNA bands were visualized using a

UV trans-illuminator.

DNA sequencing and data analysis:

The PCR product was purified using

QIAquick Gel Extraction Kit (Qiagen

Inc., Chatsworth, California) and both

strands were sequenced with an ABI377

automated DNA sequencer (Applied

Biosystems Inc., Foster City, California)

in both directions with the same primer

sets (ITS4- ITS5). Raw sequence

chromatograms were assembled and

edited using GAP4 (Bonfield et al., 1995)

to correct ambiguous bases or remove

low quality stretches from the termini of

the sequences. Homologies to known

sequences were detected using the

BLASTN algorithms (Altschul et al.,

1997) against the non-redundant

GenBank database at

http://www.ncbi.nlm.nih.gov/blast.

Multiple alignments were performed

using Cluster (Thompson et al., 1994)

and the phylogenetic analyses were

conducted with MEGA7 using the

maximum parsimony method (Tamura et

al., 2007). The ITS4/ITS5 sequences of

different

Tilletia barclayana

species used

for comparisons and were submitted to

GenBank (www.ncbi.nlm.nih.gov).

Sequence analysis was carried out in

LGC group, Germany.

Statistical analysis:

All data were

subjected to analysis of variance

according to Gomez and Gomez (1984).

Treatments mean were compared by LSD

5%. All statistical analysis was

performed using analysis of variance

technique by means of Genstat 5

computer software package.

Results and Discussion

Characteristic symptoms of kernel

smut under artificial inoculation:

During full maturity, kernel smut

characteristic symptoms appeared and

become evident. Some individual panicle

grains were partially smutted or

completely transformed to sori of black

powdery teliospores mass (Figure 1).

Black kernel smut sours of the fungus

could replace partial or entire grain

starch content. Teliospores could be

remain covered with grain glumes or

discharged and scattered from rupturing

sori and surface contaminated of grains

and leaves. Therefore, it is easy to detect

kernel smut disease visually in field.

Severity and infection development

depend on level of cultivars resistance.

Kernel smut disease has no direct effect

on vegetative growth of infected plants.

All diagnostic symptoms are in

agreement with Ou (1985), Whitney

(1992) and Biswas (2003).

Figure 1: Kernel smut symptoms, left was severe smutted

grains and right healthy ones of Giza 171 cultivar under

artificial inoculation.

Elshafey, 2018

113

Morphological characteristics of

Tilletia barclayana

:

Mature Teliospores

are light to dark brown, globose, 18-

32.9µm, whereas, sterile cells hyaline in

color 18-31µm. Teliospores comprises

three layers; the perisporium, episporium

and endosporium. Teliospores have outer

thick wall to maintain spore dormancy

state. Promycelium is frequently non-

septate, 34-523×6-7.3 µm with long

branched ones. The primary sporidia or

basidiospore are aseptate, filliform to

needle in shape, 52-75 x 1.1-2 µm. A

terminal whorl of primary sporidia bear

20 to 100 basidiospores (Table 1 and

Figures 2-5). The number of

basidiospores varied from isolate to

another in accordance with Castalbury et

al. (2005) and Carris, et al. (2006).

T.

barclayana

recorded a significant

variation in different isolates teliospores

size and this trait could be used to

identify specific specie, in agreement

with Matsumoto et al. (1985). Filliform

secondary sporidia

are septate

,

37.5-62.5

× 2.4-2.6 µm, while, Allantoid secondary

sporidia are hyaline, septate and have

crescent shape, 10-21.2 x 2.9-3.8 µm in

diameter (Table 1 and Figures 2-5)

(Carris et al., 2006).

Table 1: Morphological characteristics of Tilletia barclayana.

Type of spores

Measurements of

diameter (µm)

Development period

Appearance

Tiliospore

18-32.9 µm

20-30 days from infection of open florets

Black

Sterile cell

18-31µm

20-30 days from infection of open florets

hyaline

Promycelium

34-523× 6-7.3 µm

Germ-tube of germinated teliospores

hyaline

Basidiospore

45-70 × 1.1-2 µm

1-2 days after of tiliospore germination

hyaline

Filliform sporidia

37.5-62.5 × 2.4-2.6 µm

3-4 days after of teliospores germination

Colony was cottony

and white powdery

Allantoid sporidia

10-21.2 x 2.9-3.8 µm.

7 days after teliospores germination

Production of dark

purple pigment

Figure 2: A, colony morphology of Eg 01 isolate with reddish pigment of tilletia. B, Eg 02 with

violent pigment. C, no pigment. D, growth nature of kernel smut fungus colony, left creamy

embedded in the media, right, white cottony and convex raised colony.

Elshafey, 2018

114

Based on morphological traits, growth

nature of some isolates have convex

raised cottony colony from media surface

(Figure 2D right), while second type was

leathery embedded colony in media

(Figure 2D left). For pigment production,

there are three categories of pigments, the

first type of isolates produced reddish

color (Figure 2A), and the second have

violet (Figure 2B), and the last isolates

have white colony and creamy color

without any pigments (Figure 2C).

Therefore,

T. barclayana

fungus

reflected a wide variation in

morphological traits and these results in

agreement of Levy et al. (2001) and

Elshafey (2013).

Life cycle:

On PDA media, the

teliospores were germinated, emerging

short germ-tube and formed a non-septate

promycelium (Figure 3A-B). On the tip

of promycelium, almost 20-100 primary

sporidia were developed in whorls. In the

beginning, it folded and assembled

together to form candle-flame shape (fig

3 E). Then with the progress of time, the

attatched sporidia matured and become

unfolded to form a brush shape such as

an opening flower (Figure 3D-E). Also,

primary sporidia could be formed on the

tip of very elongated and branched

promycelium (Figure 3F). The primary

sporidia developed and differentiated to

basidiospores with length 85-127 µm that

discharged or still attached to

promycelium (Figure 3H). the non-

conjugated basidiospores that attached to

promycelium germinated and produced

mycelium which carried two types of

secondary sporidia; filliform and

allantoid sporidia with Crescent-shaped

(Figure 4I-K). Both filliform and

allantoid sporidia are arise from lateral

short sterigmata called sporogenous cells

on this dikaryon mycelium (Figure 4L-P)

(Carris et al., 2006; Ingold, 1996). The

filliform and allantoid sporidia was

curved usually have 7-9 septa, while

allantoid sporidia divided by 12-19 septa

(Figure 4Q1). Each cell of filliform and

allantoid sporidia could be germinated.

These sporidia were discharged and

germinated in turn formed binucleate

mycelium (Figure 4Q). Binucleate

mycelium that responsible to infection of

florets tissues, ovary and produced smut

sori of teliospores inside rice grains.

Finally, teliospores can be produced on

Potato Sucrose Agar (PSA) media after

formation of filliform and allantoid

sporidia to complete life cycle (Figure

4R, S). In Tilletia indica, sexual

compatible pairs of basidiospores were

coupled and conjugated through short

conjugation-tube. The conjugated pairs

of basidiospores were formed H-shape

and still attached to the promycelium.

After plasmogamy and karyogamy,

basidiospores produced binucleate

mycelium that carried both filliform and

allantoid sporidia on short strigmata.

Therefore, the strains of this fungus are

heterothallic

(Castlebury & Carris,

1999). In Tilletia barclayana,

germination of teliospores lead to

production of large numbers of non-

conjugating primary basidiospores.

Basidiospores without conjugation

developed mycelium that bears both of

filliform and allantoid sporidia. So, the

strains of this fungus were homothallic.

The obtained results in accordance with

those of Goates (1988), Durán (1987),

Vánky and Bauer (1992), Vánky and

Bauer (1995), Castlebury and Carris

(1999).

T. horrida

is homothallic based

Elshafey, 2018

115

on the presence of two nuclei in detached

basidiospores and the lack of conjugation

between basidiospores (Ou 1985; Singh

& Pavgi, 1973). Moreover, inoculation

with single and paired sporidia of

T.

horrida

demonstrated the heterothallic

nature of this pathogen (Whitney &

Frederiksen, 1975). Allantoid sporidia

could germinated and produce germ

tubes directly (Figure 4Q1, Q2) (Ingold,

1997; Ingold, 1996). In culture, Allantoid

and filiform sporidia passively dispersed,

are formed from short, lateral

sporogenous cells on the hyphae (Ingold,

1996). In conclusion Tilletia barclayana

fungus produced 4 types of spores,

Tilliospores, basidiospores, Filliform and

allantoid sporidia, (Figure 5).

Figure 3: A, germinated tiliospore with short germ tube. B,

promycelium of tiliospore. C, start of basidiospores

production on the top of promycelium. D, brush shape of

promycelium, E-G, different shapes of basidiospore

production. H, non-conjugating basidiospores. Scale bars: a-

d, G 20 μm, e, f 10 μm, H 50 μm.

Figure 4: I-K, germination of basidiospores and

production of filliform and allantoid spores. L, filliform

spores on mycelium, M, allantoid spores on mycelium, N,

mass of filliform spores, O, germination of individual

filliform spore. P, germination of individual allantoid

spore. Q1-Q3 different shapes of germinating filliform

and allantoid spores. R, teliospores combined with

allantoid spore. S, terminal teliospores produced on

sporogenous mycelia on culture. Scale bars: a-s 20 μm.

Elshafey, 2018

116

Figure 5: A, tiliospore of kernel smut at various stages of

maturity; sterile body, immature and mature teliospores. B,

basidiospore. C, Filliform sporidia. D, allantoid sporidia.

Scale bars: a 20 μm, b, c 50 μm, d 20 μm.

Figure 6: A, germination and promycelium formation. B,

start of autolysis of mycelium. C, autolysis of some

mycelium branches. D, full autolysis of promycelium of

kernel smut fungus. Scale bars: a-d 20 μm.

Under specific conditions, some

germinated spores of kernel smut

produced promycelium that start to

autolysis with time, until full lysis. On

PDA media, the teliospores were

germinated, emerging short germ-tube

and formed promycelium (Figure 6A).

Some fungal mycelium could be

autolysis and enhanced by different

factors and conditions and some

electrolytes could be liberated on media.

Therefore, the kernel smut mycelium

could subject to autolysis due to lytic

enzymes from any bacteria and other

fungi or natural autolysis. The mycelium

of kernel smut was severely affected

during autolytic phase and totally lose

their constitution (Figure 6D). The major

cell wall constituents of mycelium could

be hydrolyzed by degradation enzymes

such as chitinase and glucanases which

produced from lytic microorganisms or

present naturally in mycelium itself

(Lloyd & lockwood, 1966). Therefore,

soil lytic microorganism could be shared

in reduction of infection and inoculum

capacity from soil for this fungus by

induced autolysis of promycelium (Ko &

lockwood, 1970).

Varietal resistance of kernel smut

disease:

Some local rice cultivars in

addition to Egyptian hybrid rice (H1),

beside GZ line were evaluated against

kernel smut resistance. For kernel smut

resistance, highly significant differences

were found among rice varieties. Old

japonica short grains varieties namely;

Giza 171 was the most susceptible,

Whereas, it recorded the highest

infection percentage almost 18 and 20 as

infected panicles/ m

2

followed by Giza

178 which exhibited (12 and 14 infected

panicles/ m

2

) with highly significant

differences. Late exertion of some

panicles after complete heading in Giza

178 and H1 from unproductive tillers,

induced the severity of smut infection, it

extended the period of opening florets to

receiving smut spores compared with

Elshafey, 2018

117

some japonica tolerant varieties that their

panicles have high uniformity level in

exertion and maturation. Moreover, Giza

177 as an early maturing cultivar

recorded high infection level (6.7 and 8.6

infected panicles/ m

2

). Concerning the

widely grown varieties, Sakha 101

appears to be more tolerant than others

and exhibits some field resistance to

kernel smut, which recorded 1.37 and

1.77 infected panicles/ m

2

compared with

highly susceptible Giza 171. In addition,

Sakha 104 as second extensively grown

varieties exhibited low level of kernel

smut infection, 2.33 and 2.57 infected

panicles/ m

2

. Indica rice varieties that

distributed in constricted area such as,

Giza 182 recorded lowest infection 2 and

3.7 infected panicles/ m

2

. The new

release rice cultivars Sakha 105, Sakha

106 and Sakha 107 were exhibited low

level of infection 2.1 to 2.43. Concerning

hybrid rice varieties, H1 exhibited, a

moderate infection 4.1 compared with

the highly susceptible cultivar Giza 171.

severity of infection reflected the same

levels of infection with different

varieties, 2015 season (Table 1). The

same trend of results was recorded in

2016 season. Giza 171 as a japonica

short grain the oldest rice cultivar which

is earlier distributed on large scale all

over rice governorates so the pathogen

produced different compatible races. As

a result of long period of interaction with

the host it became highly susceptible. In

addition, Giza 171 was very late

maturing cultivar, consequently the high

primary inoculum intensity was provided

from early maturing cultivars. Giza 178

was highly susceptible specially in

belkas location whereas it was grown on

large areas for many years and the

fungus produce highly host-specific

races. The obtained results are in

agreement with those results of

Templeton (1961

)

who mentioned that

some cultivars are susceptible, while

zenith, Tauching netve 1 and Vista are

resistant. Also, Cartwright et al. (1997)

identified some susceptible to highly

susceptible rice cultivars Cypress,

LaGrue, M204, and Newbonnet as a

temperate japonica. For long grains such

as Giza 182 that restricted in small

scattered areas so these environments

not provided an opportunity for the

pathogen to high perform interaction

with the host, as a result of this weak

interaction this cultivar exhibited a

lowest infection level. Although, Sakha

101 and Sakha 104 as a japonica short

grain were covered now almost 50 % of

total cultivated areas, they recorded the

lowest level of infection. The obtained

results are in contrary with Tempelton

(1967), Biswas (2003). They found that

the long-grain cultivars are most

susceptible as predominant in USA than

short and medium grains that recorded

low and intermediate reaction

respectively. In addition, heading late

cultivars exhibited severe infection than

early maturing ones. In addition, kernel

smut caused severe smut for more 1000

acre in Texas that cultivated with

Presidio, Cheniere and XL 753 as long

grain cultivars (Uppala et al., 2017).

Elshafey, 2018

118

Table 2: Evaluation of rice cultivars resistance to kernel smut disease, 2015 and 2016 season.

Cultivar

Rice

type

Duration

days

2015

2016

No. of infected

panicles/m

2

grains/m

2

panicles/m

2

grains/m

2

Giza 171

J

160

17.67

21.23

19.70

22.67

Giza 177

J

125

6.77

8.33

8.67

9.23

Giza 178

IJ

135

12.33

14.10

14.23

15.67

Giza 179

IJ

125

1.37

1.33

1.23

2.43

Giza 182

I

126

3.57

3.33

2.33

2.90

H1

IJ

135

4.10

4.67

3.90

5.90

Sakha101

J

145

1.37

1.47

1.77

1.57

Sakha104

J

135

2.33

1.566

2.57

2.77

SAKHA105

J

125

2.43

2.90

1.57

2.33

SAKHA106

J

126

2.10

2.57

1.57

2.67

SAKHA107

J

125

2.43

3.21

1.23

2.00

GZ-7112-6-20

J

125

2.33

2.67

2.23

3.67

GZ 9807-6-3-2-1

J

120

1.33

1.90

1.00

GZ9399-4-1-1-2-1-2

IJ

120

3.90

4.23

2.23

3.43

GZ9461-4-2-1-2

IJ

125

2.33

3.77

2.90

2.43

GZ10101-5-1-1-1

J

125

1.37

2.00

2.23

1.67

GZ10144-14-4-4-1

J

125

1.37

1.33

1.57

1.43

GZ10154-3-1-1-1

J

125

1.03

1.33

1.57

1.77

GZ10305-14-1-1-2

J

125

1.37

1.00

1.23

1.43

GZ10365-2-4-1-2

J

125

1.70

1.00

1.23

1.43

L.S.D. 5%

0.790

1.248

1.258

0.896

Giza 177 was cultivated on large area

and exhibited a highly susceptible

reaction although it was the earliest

maturing cultivar. The obtained results

are in harmony with Chouhan and Verma

(1964) who noted that early maturing

cultivars were more susceptible than later

maturing ones in India. Shorter anthesis

period contributes in the direction of

resistance (Anita, 2000). There are wide

variations in resistance levels among rice

varieties (Biswas, 2003; Tempelton,

1971; Singh & Pavgi 1970). From

previous results it concluded that, the

successful crosses for management of

rice kernel smut must depend on all

tolerant cultivars; Sakha 101, Sakha 104,

Sakha 105, Giza 182 and GZ10101-5-1-

1-1, GZ10144-14-4-4-1, GZ10154-3-1-

1-1,and GZ10305-14-1-1-2 promising

lines. Depending on high resistant

varieties in past years could explain the

high progress achieved to manage kernel

smut with currently promising lines.

Therefore, the detection of new

resistance resources allow to further

progress in establishing a successful

breeding program of kernel smut. Rice

differ in their susceptibility to

T.

barclayana

but in general, short-grain

cultivars are more resistant than medium

and long grain (Carris et al., 2006).

Cluster analysis of disease

parameters:

From cluster analysis of

disease parameters (Figure 7), the cluster

divided to two main clusters. The first

main cluster compromised three

cultivars as a highly susceptible group,

Giza 171, Giza 177 japonica type and

Giza 178 indica japonica. The second

main cluster included two sub-main

clusters. The first sub-main group have

H1 Egyptian hybrid 1 as moderately

Elshafey, 2018

119

susceptible, Sakha 105, Sakha 106, Giza

182, Gz7112, GZ9461, and GZ9399. The

second sub-main cluster involved highly

resistant varieties to kernel smut

diseases. Giza 179, Sakha 101, Sakha

107, Sakha 104 in addition to some GZ

lines, GZ10144. GZ10154, GZ10305,

GZ10365, GZ9807 were located in

highly resistance group. These results in

agreement with Gravois and Bernhardt

(2000), reported that Katy, Drew and

Kaybonnet, were identified as stable,

low susceptible cultivars to rice kernel

smut. There are wide variations among

the response of different Egyptian

varieties to kernel smut inoculation. The

availability of highly resistant resources

of germplasm and efficient screening

program has a net return in disease

reduction and breeding progress.

Figure 7: cluster analysis dendrogram of different Egyptian varieties based on their response to infection of

Tilletia barclayana kernel smut fungus.

Inoculation date:

Giza 171 was

artificially inoculated at various growth

stages, there are highly significant

differences among inoculation dates.

Low infection was recorded from

inoculation at seedling stage, whereas,

the highest infection induced at

flowering stage, subsequently booting

stage recorded the second rank of

infection. Therefore, these results in

agreement with Uppala et al. (2017),

they inoculated field plots with sporidia

of smut during booting stage to ensure

infection and evaluate fungicides. The

lowest infection was recorded from both

inoculation at seedling and maximum

tillering. Infection depends on the

viability of sporidia during the season,

so inoculation with allantoid sporidia at

seedling stage induced low infection due

Elshafey, 2018

120

to lose some of their viability during this

period. However, a recent study with

T.

indica

,

T. horrida

,

T. walkeri

, and

T.

caries

demonstrated that sporidia are

remarkably durable. Sporidia were viable

for 31-49 days under (10–20% RH at

20–22

◦

C) and 56-88 days (40–50 % RH,

18ºC) (Goates, 2010; Goates, 2005).

Therefore, sporidia can survive within

reproductive stage of numerous rice

varieties. Also, both the highest infection

at flowering stage and the lowest through

inoculation at seedling proofed local

infection not systemic. The pathogen can

infects developing florets of rice plant,

growing within embryo "milk" until the

kernel enters soft dough stage. These

results in agreement with behavior of

Tilletia barclayana

that infects the open

rice flowers only at anthesis, grows

within developing rice kernel as

mycelium and eventually consumes

endosperm content, converting it into

black teliospores that survive on seed

and residue in soil (Cartwright et al.,

1994; Whitney & Frederiksen, 1975).

Other research has determined that the

fungus was capable of infecting florets

before anthesis and confirmed that the

infection process was enhanced by high

moisture during the heading phase and

disease more prevalent during rainy

years (Uppala et al., 2017; Cartwright et

al., 1995). During harvest, Teliospores

of

T. barclayana

are released from

smutted grains and survive in

contaminated soil. After rice cultivation,

teliospores were germinated and produce

primary and secondary sporidia, which

air forcibly discharged onto ovaries

through open florets and repeat disease

cycle

(Whitney, 1992). Since teliospores

serve as soil-borne primary source of

inoculum for the initiation of this

disease. Singh and Pavgi (1973) reported

that local infection of florets start with

grown of sporidia on stigma, and

penetrate through style to chalazal end of

ovary, the hyphae persist between

aleuron layer and seed coat, consume

endosperm and developing sorus. The

embryo is not invaded.

Figure 8: Effect of inoculation date on severity of kernel smut infection (no. of smutted

grains/m

2

) on rice cultivar Giza 171, 2015 and 2016 seasons.

Elshafey, 2018

121

kernel smut fungus not transmitted by

systemic infection and not infects

seedlings, but primary infection develop

from a local inoculation at anthesis by

airborne secondary sporidia (Whitney &

Frederiksen, 1975; Tullis & Johonson

1952). From the current results, infection

of smut reached the peak during

complete heading, but before anthesis

onset and decreased gradually with

inoculation after anthesis, in agreement

with Goates and Jackson (2006).

In

addition, flowering stage was the most

susceptible stage for smut infection.

This

supported by some others.

Effect of spore types on kernel smut

infection:

Japonica rice cultivar Giza

171 was inoculated with different types

of smut spores during flowering stage.

Data in Figure (9) illustrated that there

are a wide variation in infection among

types of spores. Artificial inoculation

with allantoid spores induced the highest

infection percentage since it can

germinate and directly gave binucleate

mycelium that able to invasive ovary and

all tissues of opening spikletes. Filliform

sporidia recorded second rank of

infection percentage whereas, teliospores

prompted the lowest infection

percentage. Allantoid secondary sporidia

are simply airborne that deposited on the

open florets and possibly are responsible

for most infections. The production of

infected grains was much higher with

allantoid sporidia than filliform sporidia

inoculation (Chahal

.,

2001).

Results

from several studies indicate

susceptibility only during specific

periods within boot swelling to anthesis

stage (Rush et al., 2005; Bonde et al.

2004; Kumar & Nagarajan, 1998; Bains,

1994). However, a recent study with

T.

indica

,

T. horrida

,

T. walkeri

, and

T.

caries

demonstrated that sporidia are

remarkably durable. Sporidia were

viable for 30-88 days

(Gates, 2010).

Figure 9: Effect of artificial inoculation with different type of kernel smut spores on

infection (no. of smutted grains/ m

2

) of rice cultivar Giza 171, 2015 and 2016 seasons.

Allantoid sporidia are considered as

primary and infective agent for both

T.

indica

and

T. horrida

. Natural infection

by

T. indica

occurs via airborne

Elshafey, 2018

122

inoculum during heading. In addition,

T.

horrida

and

T. indica

have same local

infection, morphological traits and

distantly related (Carris et al., 2006;

Ingold, 1996). Also, Singh

and

Pavgi

(1973) speculated that sporidia lodge on

the feathery stigma and penetrate through

the style to the chalazal end of the ovary.

Therefore, for successful varietal

resistance evaluation, reproducible and

efficient inoculation technique, allantoid

sporidia must be used in artificial

inoculated cultivars.

Survival of teliospores during two

years:

Teliospores that collected directly

from fresh harvested grain commonly

germinate poorly compared with

germination after stored for several

months to a year or longer. Therefore,

the germination percentage reached 1-4

% after grain harvest of various cultivars.

The germination percentage increased to

be 15 % after store for 6 months.

Extended the store period to 1 year

induced the germination to 32%. One

year and half later, the germination

percentage can reach a peak to more than

95%. The teliospores can survive for

more than two years, thus teliospores of

T. barclayana

successfully overwintered

to permanent fields within infected rice

grains. More than 90% of total

teliospores annually transferred in

dormancy state as a source of inoculum.

So, it is recommended to eradicate

kernel smut must use healthy seeds free

from this fungus. The teliospores can

survive for more than 2 years as a seed-

borne fungus

.

Spores

of the fungus

persistent viable for a year or two in soil

and several years in infected grain. Once

the rice field is flooded, these spores

produce a series of secondary sporidia,

which are forcibly discharged and infect

the developing grains. whereas under

laboratory and field conditions,

T.

horrida

can survive form 2 to 3 years

(Ou, 1985; Singh 1975).

Teliospores of

T.indica

and

T. horrida

have three type

of dormancy (Chahal et al., 1993); first

type is postharvest dormancy whereas

fresh harvested teliospores are poorly

germinated than stored for months or

years. For one-year storage, germination

not reached more than 50% of

teliospores under optimum stored

conditions.

Figure 10: Survival of kernel smut on rice grains of different rice cultivars

under lab conditions. MAH month after harvest

.

Elshafey, 2018

123

Second type, is long-term dormancy and

survival of teliospores in open field

contributes to this type. The third type

due to cold conditions (Thinggaard &

Leth, 2003; Rattan & Aujla 1990;

Smilanick et al., 1985; Bansal et al.,

1983; Mitra, 1935). Finally, germination

rate and ability exhibited a remarkable

increase with increasing of storage

period. Ustilospores have been found

viable following 3 years in stored grains.

They also survive passage through the

digestive tracts of domestic animals (Ou,

1985).

Molecular identification of kernel

smut fungus:

Two isolates; Eg 01, Eg

02, were utilized for molecular

identification and morphological features

that involved pigment color and colony

growth nature. The ITS region of rDNA

was amplified with primers ITS4/ITS5

and sequenced (Arruda et al., 2005). The

ITS4/ITS5 sequences of the tested

isolates were submitted and get accession

numbers in NCBI Genebank as follows;

MH042043 for isolate Eg 01, whereas

MH042044 of isolate Eg 02. The

product size was within the range 574-

699 bp of both isolates. BLAST

sequence analysis of the consensus

sequence for Egyptian isolates was

compared with worldwide ones

(GenBank Accession No.: AY837516.1,

AY837518.1, AY837519.1 and

HQ317521.1 Tilletia barclayana from

USA rice paddy fields matched with

identity of almost 74-81%. These four

USA isolates were more closely related

to MH042043.1 Eg 01. While,

DQ827708.1 from Asian isolate of

Pakistan was close to isolate Eg 01 with

name

Tilletia horrida.

For isolate Eg 02

Accession No. MH042044.1, was more

associated and close to accession

AF39894, AF399892, from china with

identity 76-80%, in addition, isolates

from India have the same trend of

identity AY425727, AY4560053 as

80%. Also, isolates of Mexico highly

matched with Egyptian isolates by

100%, accessions no. AY818970,

AY818971, AY8189774, (Figure 11 &

12A, B).

Figure 11: Phylogenetic tree constructed based on ITS region using ITS4/ITS5 primers of Tilletia

barclayana Egyptian isolates and other worldwide isolates.

Elshafey, 2018

124

Figure 12: Matched accessions of Egyptian isolates through NCBI website for Tilletia

barclayana A, and Tilletia horrida B, and their identity values.

The DNA sequence analysis

demonstrated that sequence of Egyptian

isolates was matched with isolates from

different ecological and hot spots areas

worldwide. The ITS region is most

useful for molecular systematics at the

species level, and even within species in

fungi (Meenupriya & Thangaraj, 2011).

It combines the highest discrimination

ability to closely related species with a

high PCR and sequencing success rate

across abroad range of fungi (Schoch et

al., 2012). Therefore, the Egyptian

isolates R01, R18 and R21 were

clustered together in the same clade and

closely related to some isolates of China,

USA, Japan and Vietnam. Whereas,

isolate R02 and R05 more divergent and

Elshafey, 2018

125

separated in different clades and closely

related to isolates of Iran, India, USA

and Australia. The internal transcribed

spacer (ITS) region has the highest

probability of successful identification

for the broadest range of fungi, with the

most clearly defined barcode gap

between inter- and intraspecific

variation. Egyptian isolates of

Tilletia

barclayana

were highly matched and

have high identity score with USA,

India, and China pathogen, these results

in harmony with Chahal (2001), Carris et

al. (2006) and Brooks et al. (2009),

reported that this fungus considered as

minor disease but can be changed to

major in some rice production areas such

as; India and southern USA and recorded

remarkable yield losses, In addition,

Kernel smut considered as minor with

sporadic nature but became important

economical rice fungal diseases with

severe quality and yield losses in Texas

(Uppala et al., 2017). Therefore, In

Egypt must deal with this fungus in a

proper IPM approaches under climate

change conditions.

References

Altschul SF, Madden TL, Schäffer AA,

Zhang J, Zhang Z, Miller W, Lipman DJ,

1997. Gapped BLAST (Basic Local

Alignment Search Tool) and PSI-

BLAST: a new generation of protein

database search programs. Nucleic

Acids Research 25: 3389–3402.

Anita, 2000. Studies on factors affecting

development of kernel smut of rice.

M.Sc. Thesis, Punjab Agriculture

University, Ludhiana, India.

Arruda MA, Bueno CRNC, Zamprogno KC,

Lavorenti NA, Urashima AS, 2005.

Reacao do trigo ` a Magnaporthe grisea

nos diferentes estadios de

desenvolvimento. Fitopatologia

Brasileira 30:121–126

Bains SS, 1994. Inﬂuence of wheat spikes

maturity on susceptibility to infection

and growth of sporidia of Neovossia

indica. Indian Journal of Mycology and

Plant Pathology 24: 111–15.

Biswas A, 2003. Kernel smut disease of rice:

current status and future challenges.

Environment and Ecology 21: 336–351.

Bonde MR, Berner DK, Nester SE, Peterson

GL, Olsen MW, Cunfer BM, Sim T,

2004. Survival of Tilletia indica

teliospores in different soils. Plant

Disease 88(4): 316–324.

Bonfield JK, Smith KF, Staden R, 1995. A

new DNA sequence assembly program.

Nucleic Acids Research 24: 4992–4999.

Brooks SA, Anders MM, Yeater KM, 2009.

Effect of cultural management practices

on the severity of false smut and kernel

smut of rice. Plant Disease 93:1202–

1208.

Carris LM, Castlebury LA, Goates BJ, 2006.

Nonsystemic bunt fungi Tilletia indica

and T. horrida: a review of history,

systematics and biology. Annual

Reviews Phytopathology 44: 113–33.

Cartwright RD, Lee FN, Crippen DL, Eason

R, Templeton GE, 1996. Artificial

inoculation of kernel smut of rice in

Arkansas. p. 107–110. In R.J. Norman

and B.R. Wells (ed.). Research Series,

Arkansas Agricultural Experiment

Elshafey, 2018

126

Station, Hamblen Ave, Fayetteville, AR

72704, USA.

Cartwright RD, Lee FN, Crippen DL,

Templeton GE, 1994. Kernel smut

research in Arkansas. In: B.R. Wells

(ed.). Research Series, University of

Arkansas Agricultural Experiment

Station Research Series 439: 71–77.

Cartwright RD, Lee FN, Hunter RL, Crippen

DL, Tempelton GE, 1995. Research in

Arkansas on kernel smut of rice. In: B.R.

Wells (ed). Research Series, Arkansas

Agricultural Experiment Station,

University of Arkansas, 446: 115-124.

Cartwright RD, Parsons CE, Ross WJ, Lee

FN, Templeton GE, 1997. Rice disease

monitoring in Arkansas. In: R.J. Norman

and T.H. Johnston (eds.). Arkansas Rice

Research Studies 1996. University of

Arkansas Agricultural Experiment

Station Research Series 456: 81–89.

Castlebury LA, Carris LM, 1999. Tilletia

walkeri, a new species on Lolium

multiflorum and L. perenne. Mycologia

91: 121–31

Castlebury LA, Carris LM, Vinky K, 2005.

Phylogenetic analysis of Tilletia and

allied genera in order Tilletiales

(Ustilaginomycetes:

Exobasidiomycetidae) based on large

subunit nuclear rDNA sequences.

Mycologia 97(4): 888–900.

Chahal SS, 2001. Epidemiology and

management of two cereal bunts. Indian

Phytopathology 54: 145–57

Chahal SS, Aulakh KS, Mathur SB, 1993.

Germination of teliospores of Tilletia

barclayana, the causal agent of kernel

smut of rice, lation to some physical

factors. Journal of Phytopathology 137:

301–308

CMI. 1991. Tilletia barclayana (Bref.) Sacc.

& Sydow. CMI Distribution Maps of

Plant Diseases 75 pp.

Durán R, 1987. Ustilaginales of Mexico.

Taxonomy, Symptomology, Spore

Germination, and Basidial Cytology.

Pullman, Whitman, Washington State

University, USA, 331 pp.

Elshafey RAS, 2013. Evaluation of varietal

resistance and physiological characters

of false and kernel smut diseases of rice

in Egypt. Mansoura Journal of Plant

Protection and Pathology 4(1): 125–142.

Farr DF, Rossman AY, Palm ME, McCray

EB, 2005. Fungal databases, Syst. Bot.

Mycol. Lab., ARS, USDA. http://nt.ars-

grin.gov/fungaldatabases.

Goates BJ, 1988. Histology of infection of

wheat by Tilletia indica, the Karnal bunt

pathogen. Phytopathology 78:1434–

1441.

Goates BJ, 2005. Durability of secondary

sporidia of floret infecting Tilletia

species: implications for epidemiology.

Phytopathology 95: 961.

Goates BJ, 2010. Survival of Secondary

Sporidia of Floret-Infecting Tilletia

Species: Implications for Epidemiology.

Phytopathology 100(7): 655–662.

Goates BJ, Jackson EW, 2006. Susceptibility

of Wheat to Tilletia indica during stages

of spike development. Phytopathology

96(9): 962–966.

Gomez KA, Gomez AA, 1984. Statistical

procedures for agricultural research. 2

nd

ed., John Wiley and Sons, USA.

Elshafey, 2018

127

Gravois KA, Bernhardt JL, 2000. Heritability

and genotype x environment interactions

for discolored rice kernels. Crop Science

40: 314–318.

Ko WH, Lockwood JL, 1970. Mechanism of

lysis of fungal mycelia in soil.

Phytopatholoy 60: 148–154.

Kumar J, Nagarajan S, 1998. Role of flag leaf

and spike emergence stage on the

incidence of Karnal bunt in wheat. Plant

Disease 82:1368–1370.

Levy LL, Castlebury A, Carris LM, Meyer

RJ, Pimentel G, 2001. Internal

transcribed spacer sequence-based

phylogeny and polymerase chain

reaction-restriction fragment length

polymorphism differentiation of Tilletia

walkeri and T. indica. Phytopathology

91: 935–940.

Lloyd AB, Lockwood JL, 1966. Lysis of

fungal hyphae in soil and its possible

relation to autolysis. Phytopatholoy 56:

595–602.

Matsumoto TT, Whitney NG, Bonde MR,

Royer MH, 1985. Morphological

variation of teliospores of N. horrida.

Phytopathology 75: 1365.

Meenupriya J, Thangaraj M, 2011.

Analytical characterization and

structure elucidation of metabolites

fromAspergillusochraceus MP2 fungi.

Asian Pacific Journal of Tropical

Biomedicine 1: 376–380.

Mitra M, 1935. Stinking smut (bunt) of wheat

with special reference to Tilletia indica

Mitra. Indian Journal of Agricultural

Science 1: 51–74.

Ou SH, 1985. Rice Diseases. CMI, Kew, UK,

380 pp.

Rattan GS, Aujla SS. 1990. Survival of

Karnal bunt (Neovossia indica)

teliospores in different types of soil at

different depths. Indian Journal of

Agricultural Science 60: 616–18

Rush CM, Stein JM, Bowden RL,

Riemenschneider R, Boratynski T,

Royer MH, 2005. Status of Karnal bunt

of wheat in the United States 1996 to

2004. Plant Disease 89: 212–223

Schoch CL, Seifert KA, Huhndorf S, Robert

V, Spouge JL, Levesque CA, 2012.

Nuclear ribosomal internal transcribed

spacer (ITS) region as a universal DNA

bar- code marker for fungi. Proceedings

of the National Academy of Sciences

USA 109: 6241–6246.

Sharma RC, Gill SS, Joshi DP, Rang A,

Bassi G, Bharaj TS, 1999. Kernel

smut—a major constraint in hybrid seed

production of rice and its remedial

measures. Seed Research 27: 82–90.

Singh R, Pavgi M, 1972. Cytology of

teliospore germination and development

of Neovossia horrida. Riso 21: 259–268.

Singh RA, 1975. Source of inoculum and the

epidemiology of bunt of rice. Riso 25:

77–80.

Singh RA, Pavgi MS, 1970. Varietal

Reaction and resistance to kernel bunt of

rice. Indian Phytopathology 33: 51–53.

Singh RA, Pavgi MS, 1973. Development of

sorus in kernel bunt of rice. Riso 22:

243–50.

Slaton NA, Gbur EEJ, Cartwright RD,

DeLong RE, Norman RJ, Brye KR,

2004. Grain yield and kernel smut of

rice as affected by preflood and

midseason nitrogen fertilization in

Elshafey, 2018

128

Arkansas. Agronomy Journal 96(1): 91–

99.

Smilanick JL, Hoffmann JA, Royer MH,

1985. Effect of temperature, pH, light,

and desiccation on teliospore

germination of Tilletia indica.

Phytopathology 75: 1428–31.

Tamura K, Dudley J, Nei M, Kumar S, 2007.

MEGA 4: Molecular Evolutionary

Genetics Analysis (MEGA) software

version 4.0. Molecular Biology and

Evolution 24: 1596–1599.

Templeton GE, 1961. Local infection of rice

florets by the rice kernel smut organism,

Tilletia horrida. Phytopathology 51(2):

130–131.

Thinggaard K, Leth V, 2003. Use of the

fluorochrome vital dye acridine orange

to determine viability and germination of

Tilletia indica teliospores in soil. Seed

Science and Technology 31: 329–40.

Thompson JD, Higgins DG, Gibson TJ, 1994.

CLUSTAL W: improving the sensitivity

of progressive multiple sequence

alignment through sequence weighting,

position specific gap penalties and

weight matrix choice. Nucleic Acids

Research 22: 4673–4680.

Tullis EC, Johanson AG, 1952. Synonymy of

Tilletia horrida and Neovossia

barclayana. Mycologia 44(6): 773–788.

Uppala S, Liu G, Liu B, Wu M, Zhou XG,

2017. Texas Rice Kernel Smut Research.

10.13140/RG.2.2.10801.28006.

Vánky K, 2001. Taxonomical studies on

Ustilaginales. XXI. Mycotaxon 78: 265–

326.

Vánky K, Bauer R, 1992.

Conidiosporomyces a new genus of

Ustilaginales. Mycotaxon 43: 427–436.

Vánky K, Bauer R, 1995. Oberwinkleria, a

new genus of Ustilaginales. Mycotaxon

53: 361–368.

Webster RK, Gunnell PS, 1992.

Compendium of rice diseases. American

Phytopathological Society, Minneapolis,

MN

White TJ, Bruns T, Lee S, Taylor JW, 1990.

Amplification and direct sequencing of

fungal ribosomal RNA genes for

phylogenetics. In: Innis, M.A., Gelfand,

D.H., Sninsky, J.J. & White, T.J. (Eds.)

PCR Protocols: A Guide to Methods and

Applications. Academic Press, San

Diego, California, USA, 315–322 pp.

Whitney NG, 1992. Kernel smut. In:

Compendium of Rice Diseases. R.K.

Webster and P.S. Gunnel (eds.).

American Phytopathological Society, St.

Paul, MN, USA, 28–29 pp.

Whitney NG, Frederiksen RA, 1975. Kernel

smut of rice. Publication 1231, College

Station, Texas Agricultural Experiment

Station, Texas, USA.