Journal of Phytopathology and Pest Management 8(1): 71-78, 2021
pISSN: 2356-8577 eISSN: 2356-6507
Journal homepage: http://ppmj.net/
∗
Corresponding author:
Radwa G. Mostafa,
E-mail: radwa.ahmed@agr.aun.edu.eg
71
Copyright © 2021
Morphological, morphometrical and molecular
identification of root-knot nematode
(
Meloidogyne
javanica
) infecting banana in
Assiut governorate, Egypt
Radwa G. Mostafa1*, Aida M. El-Zawahry2, Ashraf E. M. Khalil1, Ameer E. Elfarash3, Ali D. A. Allam2
1Plant Pathology Research Institute, Agricultural Research Center, Giza, Egypt
2Department of Plant Pathology, Faculty of Agriculture, Assiut University, Assiut, Egypt
3Department of Genetics, Faculty of Agriculture, Assiut University, Assiut, Egypt
Abstract
Keywords: Meloidogyne javanica, root-knot nematodes, banana, morphometric, SCAR markers.
Plant-parasitic nematodes are extremely dangerous pests in a variety of
economically important crops. Root-knot nematodes (RKN) Meloidogyne spp.
are between the major important pests causing serious crops havoc worldwide
because of their wide geographical distribution and variety of hosts. Therefore,
both of identification that is true and trustworthy of these pests is required for
evaluating various suitable management strategies. This study, aimed to
characterize morphological, morphometric and molecularly isolate of
Meloidogyne related to banana plants. Second-stage juveniles (body length, tail
length, stylet length, hyaline terminus length, and DEGO) were used in
morphometric and morphological studies and female in perineal patterns. The
results revealed that the identified nematode species, Meloidogyne javanica, is
the most common root knot nematode species in all three localities. To prove
the identification, a polymerase chain reaction (PCR)-based experiment using a
species-specific sequence described amplified regions (SCAR) primer series was
used. The Fjav/Rjav primer effectively enhanced SCAR markers of 670 bp
previously identified in M. javanica. This study confirms the use of an effective
and reliable diagnosis of RKN using the three approaches.
Mostafa Radwa et al., 2021
72
1. Introduction
Banana (
Musa
sp.) is one of the world's
most economic tropical fruit crops. It’s an
important source of carbohydrates, fibers,
proteins, vitamins, and minerals. Bananas
thrive in a wide range of soil conditions.
It’s cultivation area in Egypt reached
approximately 447299 ha, with an
average yield of 1359297 tons/ha. (FAO,
2019). Nematodes are one of the world's
most significant limitations on banana
production, with 146 species recorded in
43 genera. A most dangerous nematode
species are that, devastate the primary
roots, causing the anchorage system to
fail and the plant to fall over (Gowen et
al., 2005). When soil and root samples
were analyzed, it was discovered that
trees were severely infested with root
knot nematodes. Various procedures were
used to characterize the root-knot
nematode species like, morphometric,
morphological characters and molecular
techniques. The perineal pattern is
predominantly uncertain when used alone
to make diagnostic deduction, but when
used as an integral device in conjunction
with morphometric characterization or
molecular techniques, it is substantial for
screening the morphological match-
making of the identification (Carneiro et
al., 2004). So that, molecular diagnostics
of
Meloidogyne
sp. have been research as
a surrogate. PCR-based disclosure
methods, such as species specific or
sequence characterized amplification
region (SCAR) primers, have been
advanced and vastly used for nematode
identification (Daramola, et al., 2015).
SCAR markers are preferred over RAPD
markers because they detect only a single
locus and are more specific. Furthermore,
their PCR amplification is low sensible to
reaction constraints and thus more
reproducible. The objective of the present
study was undertaken to characterize
morphological (perineal patterns),
morphometric and molecularly (PCR
with species-specific primers) techniques
to identify the root-knot nematode
isolated from three localities (Assiut
center, Alfath and Sahel sleim) cultivated
with banana in Assiut governorate,
Egypt.
2. Materials and methods
2.1 Isolated nematode identification
The soil and root samples of root-knot
nematodes infecting banana were
obtained from three localities (Assiut,
Alfath and Sahel sleim) of Assiut
governorate, Egypt cultivated with
banana orchards. The morphological,
morphometrical, and molecular
characterization was carried out on
second-stage juveniles (J2) gained from
soil extraction and mature females
obtained from infective roots.
2.2 Morphological characterization
Sections of infected roots should be
immersed in 0.9% NaCl. Using a
dissecting microscope, separate females
from roots by needle and a scalpel and
transfer the females to a petri dish with a
small drop of 45% lactic acid. Push a
female body out of a drop in a small
isthmus of lactic acid solution, so that
surface tension holds it in place. Insert
the razor blade fragment into the slide
and use a paper cutter to cut off the
nematode's posterior. Using a dissecting
needle, gently remove body tissue from
the posterior section. In a small drop of
glycerin, place the perineal pattern on a
microscope slide. The internal surface of
the cuticle should place against the glass
then, cover slip placed on the glycerin
Mostafa Radwa et al., 2021
73
drop. (Taylor & Netscher, 1974).
2.3 Morphometrical characterization
Morphometric dimensions of
Meloidogyne
were specified on ten
individual J2 from three localities. J2 was
tentatively mounted in water on glass
slides before being spotted and measured
at 100 magnifications with a compound
light microscope (OMAX 40X-2000X
digital binocular biological compound
microscope) linked to a computer
working Scope- Image- 9.0 Professional
Imaging software. The optical
microscope was used to measure five
morphometric variables (stylet length,
tail length, body length, hyaline terminus
length, and the distance between the
stylet base and the dorsal esophageal
gland orifice (DEGO)).
2.4 Molecular characterization
2.4.1 DNA extraction
The CTAB (cetyltrimethylammonium
bromide) method was used to extract
DNA from nematode isolates (Mondino
et al., 2015)
with some modifications.
Many adult females gained from each
isolate were frozen in liquid nitrogen
then, crushed using a suitable pestle and
mortar. 600μl of CTAB extraction buffer
was added to each sample and the
mixture was then transferred to 1.5 ml
Eppendorf tube. A volume of 50μl β-
mercaptoethanol was added and all tubes
were well vortexed for 15 sec and then
incubated for about 40 min at 65
o
C in a
water bath. After incubation, the tubes
were kept at room temperature for 5-10
min, and 600μl chloroform: isoamyl
alcohol solution (24:1 v/v) was then
added to each tube, and the solution was
gently mixed. The tubes were then
subjected to a centrifugation (8,000 rpm
at 4° C for 15 min). After the
centrifugation, approximately 500μl of
the upper aqueous phase (without any
solid material) was transferred to a new
1.5 tube and an equal volume (500 μl) of
cold isopropanol was added to each tube.
The tubes were then slowly inverted
several times and stored in the
refrigerator overnight. A centrifugation
(13,000 rpm at 4° C for 10min) was
performed for the tubes. After the
centrifugation, the supernatant was
discarded and the DNA pellet was then
washed by adding 1 ml of 70% cold
ethanol, and a centrifugation (13,000 rpm
at 4° C for 5 min) was performed. The
tubes were kept at room temperature to
allow the DNA pellet to air-dry
(approximately 15 min). The dried DNA
pellet was then resuspended in 100 μl TE
buffer. DNA concentration (μg/ml) was
determined for each sample by using
spectrophotometer, and required
dilutions were then performed to be used
later for PCR.
2.4.2 Species-specific PCR assay
A species-specific SCAR primer
collection (Table 1), selected from
previous studies (Zijlstra et al., 2000) as
a specific marker for
Meloidogyne
javanica
, namely Fjav/Rjav, was used to
confirm morphological identification of
nematode isolates. Amplifications were
carried out in 25μl reaction mixtures
containing 5-10 ng of genomic DNA, 1X
PCR buffer, 1.5 mM MgCl2, 200 μM of
each dNTP, 0.8 μM of each primer, and
1 U Taq DNA-polymerase.
Amplifications were carried out using the
following PCR software in a Senso Quest
Mostafa Radwa et al., 2021
74
Lab Cycler (SensoQuest GmbH,
Göttingen, Germany): 5 minutes at 95°
C, then 35 intervals of 1 minute at 94° C,
1 minute at 58° C, and 1 minute at 72° C,
followed by one final extension period at
72° C for 10 minutes. PCR products were
separated on a 1.5 percent agarose gel
stained with ethidium bromide in 0.5 X
TBE buffer using a horizontal gel
electrophoresis unit. The size of each
amplified DNA fragment was determined
using a DNA ladder. The gel was run for
about an hour at a constant voltage of
almost 80 V, and then photographed
using a gel documentation device under
UV light. For each SCAR marker, the
same band with the predicted size was
then detected separately.
Table 1: SCAR primers were used to identify Meloidogyne javanica at the molecular level.
Name of Primer
Fragment size (bp)
Sequence (5'-3')
Reference
Fjav/Rjav
670
GGTGCGCGATTGAACTGAGC
CAGGCCCTTCAGTGGAACTATAC
Zijlstra et al. (20000
3. Results
3.1 Morphometric characters
Second-stage juveniles were vermiform
and slender ranged from 400-550 μm in
length and a head that was not offset
from the body. Stylet knobs transversely
elongate and are offset from the stylet
shaft, stylet length ranged from 9.6-12.4
μm. The distance between the dorsal
esophageal gland and the base of the
stylet was 3-4 m. Tail length was 50-62.2
μm with rounded tip. The hyaline tail
length ranged from 10.2 to 18.4 μm, with
a long slender tapering tail and a
delicately curved tail tip, which
corresponded to the characterization set
for
M. javanica
by (Karssen & Moens
2006; Eisenback, 1985). Morphometris
performed on J2 are reported in Table
(2).
Table 2: Morphometric comparison of second-stage juveniles of the Assiut isolate and Meloidogyne
javanica reported values.
Assiut isolate
M. javanica reported values
400 – 550 (475) µm
400 – 560 µm
15 – 17 (16) µm
14 –18 (16) µm
50.0 - 62.2 (56.1) µm
51.0 – 63.0 (57) µm
10.2 – 18.4 (14.3) µm
10.0 – 19.0 (14.5) µm
3 – 4 (3.5) µm
3 – 4 (3.5) µm
All measurements in micrometers with range (mean).
3.2 Perineal pattern morphology
When comparing to previous reports,
assessment of the perineal pattern’s
morphology of adult females from three
localities, selected by hand from infected
banana roots, revealed brow model of
M.
javanica
(Eisenback, 1985).
Meloidogyne
javanica
was dominant in the three
localities. The perineal patterns of
M.
javanica
are unrivaled because they
consist of side ridges that part the dorsal
and ventral lines. In generally, the ridges
run the entire width of the pattern, but
progressively die out near the tail end.
The dorsal arch is faint and rounded to
Mostafa Radwa et al., 2021
75
high and squarish and often contains a whorl in the tail terminal area.
Figure 1: Perineal pattern of Meloidogyne javanica.
The striae are sleek to little adverse, and
several striae may curvature across the
vulval edges (Figure 1).
3.3 Molecular identification of
Meloidogyne javanica
One species-specific SCAR primer pairs,
namely Fjav/Rjav were used for
molecular diagnosis of nematode isolates
to further confirm species identification.
The PCR assay was performed on one
sample from each locality. The three
nematode isolates clearly amplified the
expected specific DNA fragment of 670
bp (Figure 2) which confirms the
identification of
M. javanica
as recorded
by (Zijlstra et al
.
,
2000).
Figure 2: Amplification items (670 bp) for Meloidogyne javanica species –
Fjav/Rjav SCAR primers.
4. Discussion
Morphological and morphometric studies
necessitate a significant amount of
endeavor and are not always simple,
attributed to the prevalence of intra-
specific variations. As the previously
reported, the morphometric values
overlap, and the morphology of the
perineal pattern, while extra helpful but,
Mostafa Radwa et al., 2021
76
remains indecisive due to individual
variability, the assorted practice of those
describing the patterns, and the increased
numbering of species. The combination
of morphology and morphometrics may
provide a small hint toward species
identification. This result is agreement
with (Phan et al., 2021; Katooli et al.,
2020, Pehlivan et al., 2020; Rusinque et
al., 2018; Eisenback & Triantaphyllou,
1991).
M. javanica
is the most frequent
Meloidogyne
sp. found in tropical and
subtropical areas (Moens et al., 2009),
such as Egypt, where annual
temperatures range between 17-32˚C. It
is important to note that, while PCR is
quick, simple, and capable of
determining species identity regardless of
developmental phase and from tiny
portions of tissue. Because of
intraspecific variability and species
closeness, its dependability is uncertain.
Thus, morphology, morphometrics, and
molecular analysis work in tandem to
provide more accurate and reliable
identification. The PCR examination for
the nematode isolates with the specific
SCAR primer Fjav/Rjav clearly produces
a specific DNA piece of 670 bp (Figure
2) which confirms the identification of
M. javanica
such results were in harmony
with those (Mwesige et al., 2016; Naz et
al., 2012; Devran & Sṏḡüt, 2009; Zijlstra
et al., 2000). SCAR markers have been
to a large degree used in molecular
identity of root-knot nematodes, both to
prove morphological identifications and
to set apart unknown isolates in genomic
analysis (Naz et al., 2012; Devran &
Sṏḡüt, 2009; Jones et al., 2009; Randig et
al., 2002; Zijlstra et al., 2000). From the
results we concluded that the
morphometric, morphological, and
molecular identification were harmonic
with one another, implying that
molecular analysis of root-knot
nematodes using SCAR markers could
be used as a supplement to morphometric
and morphological identification.
References
Carneiro RMDG, Tigano MS, Randig O,
Almeida MRA, Sarah JL, 2004.
Identification and genetic diversity of
Meloidogyne spp. (Tylenchida:
Meloidogynidae) on coffee from Brazil,
Central America and Hawaii.
Nematology 6(2): 287–298.
Daramola FY, Popoola JO, Eni AO,
Sulaiman O, 2015. Characterization of
root-knot nematodes (Meloidogyne spp.)
associated with Abelmoschus esculentus,
Celosia argentea and Corchorus
olitorius. Asian Journal of Biological
Sciences 8(1): 42–50.
Devran Z, Sṏḡüt MA, 2009. Distribution and
identification of root-knot nematodes
from Turkey. Journal of Nematology
41(2): 128–133.
Eisenback JD, 1985. Detailed morphology
and anatomy of second-stage juveniles,
males, and females of the genus
Meloidogyne (root-knot nematodes). In:
An advanced treatise on Meloidogyne,
Volume I, Sasser JN, Carter CC (Eds.),
North Carolina State University
Graphics, Raleigh, USA, pp. 47–77.
Eisenback JD, Triantaphyllou HH, 1991.
Root-knot nematodes: Meloidogyne
species and races, In: Manual of
Agricultural Nematology, Nickle WR
(Eds.), Marcell Dekker, New York, USA
pp. 191–274
FAO, 2019. Food and Agriculture
Organization of the United Nations.
Available online at
Mostafa Radwa et al., 2021
77
http://www.fao.org/faostat/en/#data/QC.
Gowen SR, Quénéhervé P, Fogain R, 2005.
Nematode parasites of bananas and
plantains. In: Plant parasitic nematodes
in subtropical and tropical agriculture,
Luc M, Sikora RA, Bridge J (Eds.). CAB
International, Wallingford, UK, pp. 611–
643.
Jones JT, Kumar A, Pylypenko LA,
Thirugnanasambandam A, Castelli L,
Chapman S, Cock PJA, Grenier E, Lilley
CJ, Phillips MS, Blok VC, 2009.
Identification and functional
characterization of effectors in expressed
sequence tags from various life cycle
stage of the potato cyst nematode
Globodera pallida. Molecular Plant
Pathology 10(6): 815–828.
Karssen G, Moens M, 2006. Root knot
nematodes. In: Plant Nematology, Perry
RN, Moens M (Eds.), CABI Publishing,
Wallingford, UK, pp. 59–90.
Katooli N, Moghadam EM, Aghnoum R,
2020. Morphological and Molecular
Identification of Major Species of
Meloidogyne and Distribution there in
Pomegranate Orchards in Khorasan
Provinces. Journal of Plant Protection
34(3): 297–308.
Moens M, Perry RN, Starr JL, 2009.
Meloidogyne species a diverse group of
novel and important plant parasites. In:
Root-knot nematodes. CABI
international, Cambridge, Massachusetts,
USA, pp.1–17.
Mondino EA, Covacevich F, Studdert GA,
Pimentel JP, Berbara RL, 2015.
Extracting DNA of nematodes
communities from Argentine Pampas
agricultural soils. Annals of the Brazilian
Academy of Sciences 87(2): 691–697.
Mwesige R, Seid A, Wesemael W, 2016.
Root-knot nematodes on tomatoes in
Kyenjojo and Masaka districts in
Uganda. African Journal of Agricultural
Research 11(38): 3598–3606.
Naz I, Palomares-Rius JE, Blok V, Saifullah,
Ali S, Ahmad M, 2012. Prevalence,
incidence and molecular identification of
root-knot nematodes of tomato in
Pakistan. African Journal of
Biotechnology 11(100): 16546–16556.
Pehlivan HD, Kaskavalcl G, Uludamar EK,
Toktay H, Elekciohlu H, 2020.
Identification and prevalence of potato
cyst nematodes and root-knot nematodes
in the potato production areas of İzmir
Province, Turkey. Turkish Journal of
Entomology 44(2): 259–272.
Phan KL, Linh Le TM, Nguyen HT, Nguyen
TD, Trinh QP, 2021. First report and
new molecular and morphological
characterizations of root-knot nematode,
Meloidogyne javanica, infecting ginger
and long coriander in Vietnam. Journal
of Nematology 53: 1–8.
Randig O, Bongiovanni M, Carneiro RMDG,
Castagnone-Sereno P, 2002. Genetic
diversity of root-knot nematodes from
Brazil and development of SCAR
marker specific for the coffee damaging
species. Genome 45: 862–870.
Rusinque L, Inácio ML, Mota M, Nóbrega F,
2018. Morphological, biochemical and
molecular characterisation of
Meloidogyne javanica, from North
Portugal, in tomato. Revista de Ciências
Agrárias 41(1): 193–198.
Taylor DP, Netscher C, 1974. An improved
technique for preparing perineal patterns
of Meloidogyne spp. Nematological
20(2): 268–269.
Zijlstra C, Donkers-Venne DTHM, Fargette
M, 2000. Identification of Meloidogyne
incognita, M. javanica and M. arenaria
using sequence characterized amplified
Mostafa Radwa et al., 2021
78
region (SCAR) based PCR assays.
Nematology 2: 847–853.